Home Tools
Log in
Cart

UNC1999

Catalog No. T3057   CAS 1431612-23-5

UNC1999 is a orally bioavailable, effective and specific inhibitor of EZH2 (IC50=2 nM) and EZH1 (IC50=45).

All products from TargetMol are for Research Use Only. Not for Human or Veterinary or Therapeutic Use.
UNC1999 Chemical Structure
UNC1999, CAS 1431612-23-5
Pack Size Availability Price/USD Quantity
1 mg In stock $ 31.00
2 mg In stock $ 44.00
5 mg In stock $ 65.00
10 mg In stock $ 98.00
25 mg In stock $ 187.00
50 mg In stock $ 302.00
100 mg In stock $ 543.00
500 mg In stock $ 1,190.00
1 mL * 10 mM (in DMSO) In stock $ 91.00
Bulk Inquiry
Get quote
Select Batch  
Purity: 100%
Purity: 99.7%
Purity: 99.49%
Contact us for more batch information
Biological Description
Chemical Properties
Storage & Solubility Information
Description UNC1999 is a orally bioavailable, effective and specific inhibitor of EZH2 (IC50=2 nM) and EZH1 (IC50=45).
Targets&IC50 EZH2:2 nM, EZH1:45 nM
In vitro In the MCF10A cell line, UNC1999 demonstrates relatively low cytotoxicity with an IC50 of 124 nM and reduces H3K27me3 levels in a concentration-dependent manner. It also inhibits cell proliferation concentration-dependently in DLBCL cell lines containing the EZH2Y641N mutation.
In vivo In animal studies, intraperitoneal injection of UNC1999 (50-150 mg/kg) effectively elevated the concentration levels in animal plasma above the cellular IC50 value.
Kinase Assay Scintillation Proximity Assay: Methyltransferase activity assays are performed by monitoring the incorporation of tritiumlabeled methyl group from S-adenosylmethionine (3H-SAM) to biotinylated peptide substrates using Scintillation Proximity Assay (SPA) for PRC2-EZH2 trimeric complex (EZH2:EED:SUZ12), PRC2-EZH1 pentameric complex (EZH1:EED:SUZ12:RBBP4:AEBP2), SETD7, G9a, GLP, SETDB1, SETD8, SUV420H1, SUV420H2, SUV39H2, MLL1 tetrameric complex (MLL:WDR5:RbBP5:ASH2L), PRMT1, PRMT3, PRMT5-MEP50 complex and SMYD2. The reaction buffer for SMYD2 and SMYD3 is 50 mM Tris pH 9.0, 5 mM DTT, 0.01% TritonX-100; for G9a, GLP and SUV39H2 is 25 mM potassium phosphate pH 8.0, 1 mM EDTA, 2 mM MgCl2 and 0.01% Triton X-100; and for other HMTs 20 mM Tris pH 8.0, 5 mM DTT, 0.01% TritonX-100. To stop the enzymatic reactions, 10 μL of 7.5 M guanidine hydrochloride is added, followed by 180 μL of buffer, mixed and transferred to a 384-well FlashPlate. After mixing, the reaction mixtures are incubated and the CPM counts are measured using Topcount plate reader. The CPM counts in the absence of compound for each data set are defined as 100% activity. In the absence of the enzyme, the CPM counts in each data set are defined as background (0%). IC50 values are determined using compound concentrations ranging from 100 nM to 100 μM. The IC50 values are determined using SigmaPlot software. EZH2-Y641F assays are performed using 30 nM of enzyme in 20 mM Tris pH 8, 5 mM DTT, 0.01% Triton X-100, 5 μM SAM and 1 μM of H3 (1-24) peptide (same as for the wild-type PRC2-EZH2 complex). For DNMT1, the assay is performed using hemimethylated dsDNA as a substrate. The dsDNA substrate is prepared by annealing two complementary strands (biotintlated forward strand: BGAGCCCGTAAGCCCGTTCAGGTCG and reverse strand: CGACCTGAACGGGCTTACGGGCTC), synthesized by Eurofins MWG Operon. Reaction buffer is 20 mM Tris-HCl, pH 8.0, 5 mM DTT, 0.01% Triton X-100.Methyltransferase activity assays for DOT1L is performed using Filter-plates. Reaction mixtures in 20 mM Tris-HCl, pH 8.0, 5 mM DTT, 2 mM MgCl2 and 0.01% Triton X-100 are incubated at room temperature for 1h, 100 μL 10% TCA is added, mixed and transferred to filter-plate. Plates are centrifuged at 2000 rpm for 2 min followed by 2 additional 10% TCA wash and one ethanol wash (180 μL) followed by centrifugation. Plates are dried and 100 μL MicroO is added and centrifuged. 70 μL MicroO is added and CPM are measured using Topcount plate reader.
Cell Research DB cells, a diffuse-large B-cell lymphoma cell line harboring the EZH2 Y641N mutation, are obtained from ATCC and cultured in RPMI 1640 supplemented with 10% fetal bovine serum, antibiotics, and various concentrations of compounds (DMSO control, UNC1999, or UNC2400). The medium containing the test compound or control is refreshed every 3 days. The numbers of viable cells from at least three independent experiments are measured using TC20 automated cell counter system. Total histones are prepared from cell nuclei using an acidic extraction protocol. About 1 μg of total histones is separated using 15% SDS-PAGE, transferred to PVDF membranes, and probed with histone antibodies. Antibodies used in this study are those against EZH2, general H3, and H3K27me3. (Only for Reference)
Molecular Weight 569.74
Formula C33H43N7O2
CAS No. 1431612-23-5

Storage

Powder: -20°C for 3 years | In solvent: -80°C for 1 year

Solubility Information

Ethanol: 44 mg/mL(77.2 mM)

DMSO: 100 mg/mL (175.51 mM)

TargetMolReferences and Literature

1. Konze KD, et al. ACS Chem. Biol. 2013, 8 (6), 1324–1334. 2. Structural Genomics Consortium.

TargetMolCitations

1. Yan Y, Tian M, Li M, et al. ASH1L haploinsufficiency results in autistic-like phenotypes in mice and links Eph receptor gene to autism spectrum disorder. Neuron. 2022

Related compound libraries

This product is contained In the following compound libraries:
Inhibitor Library Highly Selective Inhibitor Library Chromatin Modification Compound Library Orally Active Compound Library Reprogramming Compound Library Anti-COVID-19 Compound Library Apoptosis Compound Library Stem Cell Differentiation Compound Library Anti-Aging Compound Library Autophagy Compound Library

Related Products

Related compounds with same targets
Valemetostat Metoprine UNC3866 TFA(1872382-47-2 free base) NSD2-IN-4 SGC-iMLLT PRMT5-IN-25 EPZ032597 PRMT6-IN-3

TargetMolDose Conversion

You can also refer to dose conversion for different animals. More

TargetMol In vivo Formulation Calculator (Clear solution)

Step One: Enter information below
Dosage
mg/kg
Average weight of animals
g
Dosing volume per animal
ul
Number of animals
Step Two: Enter the in vivo formulation
% DMSO
%
% Tween 80
% ddH2O
Calculate Reset

TargetMolCalculator

Molarity Calculator
Dilution Calculator
Reconstitution Calculation
Molecular Weight Calculator
=
X
X

Molarity Calculator allows you to calculate the

  • Mass of a compound required to prepare a solution of known volume and concentration
  • Volume of solution required to dissolve a compound of known mass to a desired concentration
  • Concentration of a solution resulting from a known mass of compound in a specific volume
See Example

An example of a molarity calculation using the molarity calculator
What is the mass of compound required to make a 10 mM stock solution in 10 ml of water given that the molecular weight of the compound is 197.13 g/mol?
Enter 197.13 into the Molecular Weight (MW) box
Enter 10 into the Concentration box and select the correct unit (millimolar)
Enter 10 into the Volume box and select the correct unit (milliliter)
Press calculate
The answer of 19.713 mg appears in the Mass box

X
=
X

Calculator the dilution required to prepare a stock solution

Calculate the dilution required to prepare a stock solution
The dilution calculator is a useful tool which allows you to calculate how to dilute a stock solution of known concentration. Enter C1, C2 & V2 to calculate V1.

See Example

An example of a dilution calculation using the Tocris dilution calculator
What volume of a given 10 mM stock solution is required to make 20ml of a 50 μM solution?
Using the equation C1V1 = C2V2, where C1=10 mM, C2=50 μM, V2=20 ml and V1 is the unknown:
Enter 10 into the Concentration (start) box and select the correct unit (millimolar)
Enter 50 into the Concentration (final) box and select the correct unit (micromolar)
Enter 20 into the Volume (final) box and select the correct unit (milliliter)
Press calculate
The answer of 100 microliter (0.1 ml) appears in the Volume (start) box

=
/

Calculate the volume of solvent required to reconstitute your vial.

The reconstitution calculator allows you to quickly calculate the volume of a reagent to reconstitute your vial.
Simply enter the mass of reagent and the target concentration and the calculator will determine the rest.

g/mol

Enter the chemical formula of a compound to calculate its molar mass and elemental composition

Tip: Chemical formula is case sensitive: C10H16N2O2 c10h16n2o2

Instructions to calculate molar mass (molecular weight) of a chemical compound:
To calculate molar mass of a chemical compound, please enter its chemical formula and click 'Calculate'.
Definitions of molecular mass, molecular weight, molar mass and molar weight:
Molecular mass (molecular weight) is the mass of one molecule of a substance and is expressed n the unified atomic mass units (u). (1 u is equal to 1/12 the mass of one atom of carbon-12)
Molar mass (molar weight) is the mass of one mole of a substance and is expressed in g/mol.

bottom

Tech Support

Please see Inhibitor Handling Instructions for more frequently ask questions. Topics include: how to prepare stock solutions, how to store products, and cautions on cell-based assays & animal experiments, etc.

Keywords

UNC1999 1431612-23-5 Autophagy Chromatin/Epigenetic Histone Methyltransferase UNC 1999 Inhibitor UNC-1999 inhibit inhibitor

 

TargetMol