irs

Irsogladine (Dicloguamine) is an anti-gastric ulcer agent that facilitates gap-junctional intercellular communication through M1 muscarininc acetylcholine receptor binding.

Cirsiumaldehyde is a compound isolated from the mature fruits of Lobelia chinensis, Cornus officinalis, and the fruits of Hippophae rhamnoides.Cirsiumaldehyde in the presence of collagen inhibited U46619-induced (1~5 uM) The inhibitory concentration of Cirsiumaldehyde on U46619-induced (1~5 uM) rat platelet aggregation in the presence of collagen was 0.8~1.0 ug/mL.

Firsocostat (GS-0976) is an inhibitor of acetyl-CoA carboxylase (ACC) dimerization that inhibits human ACC1 and ACC2 activity (IC50s of 2.1 and 6.1 nM, respectively)

Cholesterol (cholesteryl alcohol) is a natural product that is the major sterol in mammals and an agonist of estrogen-related receptor α (ERRα). Cholesterol is widely found in the cell membranes of animals and is also used in the synthesis of several important hormones and bile acids.

Virstatin is a novel antiviral drug that is a potent inhibitor of viral replication and has been shown to be effective against a wide range of viruses, including herpes simplex virus (HSV), human immunodeficiency virus (HIV) and influenza virus.

Aganirsen, a 25-mer DNA antisense oligonucleotide, silences the expression of insulin receptor substrate-1 (IRS-1).

Firsocostat S enantiomer is the less active S enantiomer of Firsocostat.

Fomivirsen sodium is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen sodium binds to and degrades the mRNAs encoding CMV immediate-early 2 protein (required for viral replication), thus providing bioactive effects for CMV retinitis by inhibition of virus proliferation.

8alpha-Hydroxyhirsutinolide shows anti-inflammatory activity, it inhibits TNF-α-induced NF-κB activity with the IC(50) value of 1.9 uM.

Trecovirsen (GEM91), a 25-mer antisense phosphorothioate oligonucleotide, targets the gag site of the HIV gene.

Eteplirsen (AVI 4658) is a synthetic antisense oligonucleotide employed in Duchenne muscular dystrophy research.

Hirsutine induces apoptosis and is a potent Dengue virus inhibitor exhibiting low cytotoxicity.Hirsutine has anticancer, cardioprotective, anti-hypertensive and anti-arrhythmic activities, it also has vasodilatation activity, the mechanism is related to blockade of Ca2+ influx through L-type Ca2+ channels and inhibition of intracellular Ca2+ release may have no relationship with K+ channels.

8alpha-(2-Methylacryloyloxy)-1-O-methylhirsutinolide 13-O-acetate is a natural product for research related to life sciences. The catalog number is TN3293 and the CAS number is 883872-71-7.

Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122 . Miravirsen (SPC-3649) is used in the study for HCV infections.

Cirsimarin (Cirsitakaoside) is a flavonoid isolated from Microtea debilis. It shows a potent antilipogenic effect and decreases adipose tissue deposition in mice. Cirsimarin has antagonist activity on the adenosine A1 receptor and inhibitory effect on phosphodiesterase.

Cirsilineol (Eupatrin) is isolated from the herb of Artemisia vestita Wall and shows immunosuppressive, anti-proliferative, and anti-tumor properties. Cirsilineol selectively induces apoptosis via the mitochondrial pathway.

Fomivirsen (ISIS-2922 free base), a 21-mer phosphorothioate antisense oligonucleotide, serves as an antiviral agent, particularly in CMV research, including AIDS studies. It functions by binding to and degrading the mRNAs that encode for the CMV immediate-early 2 protein, effectively inhibiting viral proliferation [1] [2].

Danvatirsen, an antisense oligonucleotide targeting STAT3, demonstrates potential antitumor activity by binding to STAT3 mRNA. This interaction inhibits the translation of the transcript, resulting in the suppression of STAT3 expression, which in turn induces tumor cell apoptosis and reduces tumor cell growth.

Hirsutide is a cyclotetrapeptide fungal metabolite produced by the entomopathogenic fungus Hirsutella. It has antibacterial activity against C. pyogenes, S. aureus, P. aeruginosa, and K. pneumonia (MICs = 25, 13, 6, and 21 μg/cm3, respectively). Hirsutide also has antifungal activity against C. albicans, M. audouinii, A. niger, and Ganoderma (MICs = 13, 6, 25, and 6 μg/cm3, respectively).

Golodirsen (SRP-4053) is a phosphorodiamidate morpholino oligomer (PMO) designed to selectively bind to exon 53 of dystrophin pre-mRNA, used in the investigation of Duchenne muscular dystrophy (DMD).

Lademirsen (SAR339375; RG-012) is a highly specific antisense oligonucleotide (ASO) targeting miR-21, with potential applications in Alport nephropathy research.

Hirsutanonol 5-O-glucoside (catalog number: TN4211; CAS number: 93915-36-7) is a natural product used in life sciences research.

Irsenontrine (E2027) is a selective and orally active inhibitor of phosphodiesterase 9 (PDE9), primarily used for researching neurological diseases.

Firsocostat S enantiomer (ND-630 S enantiomer) is the less active S enantiomer of Firsocostat. Firsocostat is an acetyl-CoA carboxylase ( ACC ) inhibitor.

Suvodirsen (WVE-210201) is an oligonucleotide compound with potential applications in the study of Duchenne muscular dystrophy (DMD).

Irsenontrine (E2027) maleate is a selective and orally active inhibitor of phosphodiesterase 9 (PDE9). It can be utilized in the study of neurological diseases.

Custirsen, a highly specific antisense oligonucleotide, inhibits the production of clusterin—an antiapoptotic protein upregulated in response to chemotherapy, thereby conferring treatment resistance.

Cimdelirsen is a novel, ligand-conjugated, hepatic-targeted investigative antisense oligonucleotide designed to reduce growth hormone receptor (GHr) synthesis, thereby inhibiting the harmful effects of growth hormone (GH) hypersecretion and lowering circulating insulin-like growth factor-1 (IGF-1) levels in acromegaly patients.

Cirsiliol 4′-glucoside, a compound extracted from Ruellia tuberosa L., acts as a free radical scavenger and demonstrates potential anti-diabetic activity [1].

Nirsevimab (MEDI8897) is a recombinant human respiratory syncytial virus (RSV) monoclonal antibody with a modified Fc region, efficiently targeting RSV-B with a Kd value of 1.5 nM, and can be used to prevent RSV infection.

8alpha-(2-Methylacryloyloxy)hirsutinolide is a natural product for research related to life sciences. The catalog number is TN3295 and the CAS number is 188293-70-1.

(R)-Irsenontrine ((R)-E2027), the R-enantiomer of Irsenontrine, is a potent inhibitor of phosphodiesterase 9 (PDE9) with an IC50 of 0.041 μM, primarily used in neurological disease research [1].

8alpha-Tigloyloxyhirsutinolide 13-O-acetate shows inhibitory activity toward CYP2A6 and MAO-A and MAO-B enzymes. 8alpha-Tigloyloxyhirsutinolide 13-O-acetate has anti-cancer activity, it is active against both cancer cell lines (IC50 = 3.50 microM for HT29

Hirsuteine is a natural product. It non-competitively antagonizes nicotine-mediated dopamine release by blocking ion permeation through nicotinic receptor channel complexes.

Fazirsiran (ARO-AAT), a second-generation RNAi agent, comprises a cholesterol-conjugated RNAi trigger (chol-RNAi) that selectively degrades AAT mRNA via RNAi, and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) as the excipient EX1 to enhance endosomal escape of chol-RNAi in hepatocytes [1].

Hirsutenone has potent antioxidant activity, it shows significant free radical scavenging activity and exhibits inhibition effect on the mitochondrial lipid peroxidation.Hirsutenone exhibits anti-cancer, and anti-filarial effects, it may exert a preventive effect against microbial endotoxin lipopolysaccharide-induced inflammatory skin diseases through inhibition of ERK pathway-mediated NF-kappaB activation. Hirsutenone attenuates adipogenesis by directly targeting PI3K and ERK during MCE in 3T3-L1 preadipocytes, underscoring the potential therapeutic application of Hirsutenone in preventing obesity.

Hirsutanonol is a secondary metabolite from the bark of Alnus glutinosa. Hirsutanonol has potent antioxidant and free radical scavenging activities and exhibits an inhibition effect on mitochondrial lipid peroxidation. Hirsutanonol can be used for studies

8alpha-(2-Methylacryloyloxy)hirsutinolide 13-O-acetate shows inhibitory activity toward CYP2A6 and MAO-A and MAO-B enzymes.

Cimdelirsen, a novel ligand-conjugated, hepatic-targeted antisense oligonucleotide under investigation, aims to diminish growth hormone receptor (GHr) synthesis. This inhibits the harmful effects of growth hormone (GH) hypersecretion and lowers circulating insulin-like growth factor-1 (IGF-1) levels in acromegaly patients.

Bepirovirsen, an antisense oligonucleotide, targets all HBV messenger RNAs, resulting in decreased levels of HBV-derived RNAs, HBV DNA, and viral proteins. It is utilized in researching chronic HBV infection. The binding site sequence of Bepirovirsen is (GCACTTCGCTTCACCTCTGC) [1].

Cirsimaritin exhibits antibacterial, anti-inflammation, anti-tumor, antioxidant properties and renal protection. Cirsimaritin binds weakly to the benzodiazepine site on GABAA receptors.

Cirsiliol is a 5-lipoxygenase (5-LOX) inhibitor and low affinity benzodiazepine receptor ligand.Cirsiliol inhibits cell proliferation and promotes apoptosis of OS cells.Cirsiliol shows antitumor activity against OS cells in an in situ xenograft tumor model and can be used to study colon cancer.

NT157 is a small molecule tyrphostin targeting IRS protein and has the potential to inhibit IGF-1R and STAT3 signaling pathways in TME cancer cells and stromal cells, resulting in decreased cancer cell survival.

MID-1 is an inhibitor of MG53-IRS-1 (Mitsugumin 53-Insulin Receptor Substrate-1) interaction. It disrupts molecular association of MG53 with IRS-1 and abolishes MG53-induced IRS-1 ubiquitination and degradation in skeletal muscle, leading to elevated IRS-1 expression level and increased insulin signaling and glucose uptake

Marein shows neuroprotective effect on PC12 cell damage induced by methylglyoxal, which is due to a reduction of damage to mitochondria function and activation of the AMPK signal pathway, it may be a potent compound for preventing/counteracting diabetic e

1.(-)-Licarin B (Licarine B) has anti-mycobacterial activity.

Pinusolide is a platelet activating factor ( PAF) antagonist, it may prove of therapeutic value in the treatment of hypotension, it has antileukemic potential, and could be used to treat neurodegenerative diseases. Pinusolide attenuates blockade of insulin signaling by enhancing IRS-1 tyrosine phosphorylation by the activating the AMPK pathway, indicates the targeting of AMPK represents a new therapeutic strategy for hyperglycemia-induced insulin resistance and type 2 diabetes.

Tectoruside is a phenolic glycoside derived from Iris and Leopard lily with antimutagenic and antioxidant activity that attenuates palmitate-induced endothelial insulin resistance by targeting ROS-associated inflammation and the IRS-1 pathway Tectoruside can be used in cancer research.