alzheimer

Rivastigmine (Exelon) is a Cholinesterase Inhibitor, used for therapy of Alzheimer disease.

J-147 is an experimental drug with reported effects against both Alzheimer's disease and ageing in mouse models of accelerated aging. It is a curcumin derivative and a potent neurogenic and neuroprotective drug candidate initially developed for the treatment of neurodegenerative conditions associated with aging that impacts many pathways implicated in the pathogenesis of diabetic neuropathy.

Kyotorphin acetate is an endogenous peptide with analgesia activity and can be used as a biomarker of Alzheimer disease.

(+)-OSU 6162 (Piperidine, 3-[3-(methylsulfonyl)phenyl]-1-propyl-, (3R)-) is an agonist of 5-HT Receptor with anti-Alzheimer and antidepressant activities.

TNF/IFNγ-IN-1 (TGA) is a dual inhibitor of TNF and IFN-γ. TNF/IFNγ-IN-1 has potential antioxidant and anti-inflammatory activities for neurodegenerative diseases such as Alzheimer.

Amyloid β Peptide (42-1)(human) acetate is the inactive form of Amyloid β Peptide (1-42). Amyloid β Peptide (42-1)(human) acetate is a 42-amino acid peptide which plays a key role in the pathogenesis of Alzheimer disease.

SSR 180 is a potent and subtype-selective α7 agonist with applications in the study of Alzheimer;s disease and schizophrenia.

EO-1606 is a p38MAP kinase inhibitor with anti-inflammatory activity and may be used in studies of Alzheimer;s disease and dermatitis.

β-Amyloid (1-42), human, is a 42-amino acid peptide integral to the pathogenesis of Alzheimer disease.

Colivelin is a neuroprotective peptide and activator of STAT3. Colivelin is a hybrid peptide synthesized to enhance the neuroprotective effects of humanin (HN).

EHT 1864 (EHT 1864 2HCl) is a Rac family GTPase inhibitor that blocks activation by direct binding to Rac1, Rac1b, Rac2, and Rac3 (Kd=40 50 60 250 nM). EHT 1864 inhibits Rac, Ras, and Tiam-induced growth transformation of NIH-3T3 fibroblasts.

MSDC 0160 (CAY10415) is a prototype mTOT-modulating insulin sensitizer being used in trials studying the treatment of Type 2 Diabetes and Alzheimer's Disease.

ALZ-801 is an orally available, valine-conjugated prodrug of tramiprosate. ALZ-801 is an advanced and markedly improved candidate for the treatment of Alzheimer's disease. ALZ-801 is a potent and orally available small-molecule β-amyloid (Aβ) anti-oligomer and aggregation inhibitor, a valine-conjugated prodrug of Tramiprosate with substantially improved PK properties and gastrointestinal tolerability compared with the parent compound.

Emraclidine (CVL-231), a muscarinic M4 receptor positive allosteric modulator, is utilized in studies of neurological diseases.

PF-04995274 is an effective, high-affinity, and partial serotonin 4 receptor (5-HT4R) agonist. PF-04995274 is brain penetrant and can be used for cognitive disorders associated with Alzheimer's disease. PF-04995274 has an EC50 range of 0.26-0.47 nM for hu

Jujuboside A, a glycoside extracted from Semen Ziziphi Spinosae, exhibits neurophysiological inhibitory effects and is considered a potential therapeutic agent for the treatment of Alzheimer’s disease.

ZSET1446 (ST-101) is a T-type calcium channel activator potentially for the treatment of learning deficits in various types of Alzheimer disease (AD) models.

Lazabemide hydrochloride (N-(2-Aminoethyl)-5-chlor-2-pyridincarbox) is a reversible and selective mao-b inhibitor(Ki：7.9nM).

FK962 is an somatostatin release enhancer , exerts cognitive-enhancing actions.

PF-04802367 is a highly selective GSK-3 inhibitor with an IC50 of 2.1 nM based on a recombinant human GSK-3β enzyme assay and 1.1 nM based on ADP-Glo assay. It shows desirable central nervous system (CNS) properties and potency. It is equally effective at inhibition of the two known GSK-3 isoforms (GSK-3α and GSK-3β) with IC50 values of 10.0 and 9.0 nM in mobility shift assays, respectively.

saponaretin, an active component of many traditional Chinese medicines, shows various activities, such as anti-oxidant, anti-inflammatory, anti-alzheimer disease (AD) effects and so on.

CX516 (Ampalex), an ampakine and nootropic, acts as an AMPA receptor positive allosteric modulator as a therapy for Alzheimer's disease, schizophrenia and mild cognitive impairment (MCI).

Ipidacrine (NIK‐247) (NIK‐247) is an Antidementia Agent

VU0071063 is a Kir6.2/SUR1 activator.

PBD-150 is an inhibitor of human glutaminyl cyclase (hQC) Y115E-Y117E variant( ki : 490 nM)

Leptomerine (IC50 = 2.5 mM) shows potent anticholinesterasic activity.

Arjunolic acid has antioxidant, anti-inflammatory, antinociceptive and anticholinesterasic (AChE and BuChE) activities, it may as promising targets for the development of innovative multi-functional medicines for Alzheimer desease treatment.

Amyloid precursor c-terminal peptide has the amino acid sequence Gly-Tyr-Glu-Asn-Pro-Thr-Tyr-Lys-Phe-Phe-Glu-Gln-Met-Gln-Asn. APP is best known as the precursor molecule whose proteolysis generates beta-amyloid (Aβ), a 37 to 49 amino acid peptide whose am

Lp-PLA2-IN-14 (Compound 19), an inhibitor of rhLp-PLA2, exhibits a potent inhibitory effect with a pIC50 value of 8.4 and is applicable in research on neurodegenerative disorders including Alzheimer Disease (AD), glaucoma, age-related macular degeneration (AMD), and cardiovascular diseases such as atherosclerosis [1].

TZ4M, a 2,4-thiazolidinedione (TZD)-based anti-ADV agent, exhibits neuroprotective effects and acetylcholinesterase (AChE) inhibition in human plasma. It enhances memory and cognitive function in adult rats within a scopolamine-induced Alzheimer-type model [1].

Nrf2-ARE hMAO-B QR2 modulator 1, a new resveratrol-based multitarget-directed ligand (MTDL), exhibits a well-balanced MTDL profile: it activates the NRF2-ARE pathway (CD = 9.83 μM), selectively inhibits both hMAO-B and QR2 (IC50s = 8.05 and 0.57 μM), and effectively promotes hippocampal neurogenesis. It exerts neuroprotective and antioxidant actions in both acute and chronic Alzheimer models using hippocampal tissues.

Hydroxytacrine maleate (Velnacrine maleate) is a cholinesterase (cholinesterase) inhibitor that enhances memory in rodents and may be used in the study of Alzheimer's dementia of the Alzheimer type (SDAT).

Leucyl-phenylalanine amide is an intermediate in the synthesis of γ-Secretase Inhibitor, the enzyme complex that catalyzes the cleavage of the amyloid precursor protein (APP) to produce amyloid β-peptide (Aβ) which is the major causative agent in Alzheime

MCI-225 is a norepinephrine reuptake/5-HT3/5-HT reuptake inhibitor. MCI-225 could be effective in the treatment of senile dementia of the Alzheimer type, which is accompanied with both deficit in the BF-cortex cholinergic neuron and cerebral glucose hypom

Triacsin C (WS 1228A) from Streptomyces aureofaciens is a differential inhibitor of arachidonic acid coenzyme A synthetase and non-specific long-chain acyl-coenzyme A synthetase, with anti-atherosclerotic activity, inhibition of ACSL activity, and inhibition of the accumulation of TAGs into lipid droplets (LDs).Triacsin C has been used to study rotavirus infection and Alzheimer;s disease. Triacsin C is used to study rotavirus infection and Alzheimer;s disease.

Pozanicline dihydrochloride (ABT-089 dihydrochloride) is an orally bioavailable agonist of the nicotinic acetylcholine receptor (nAChR) with a Ki of 16.7 nM.

Medioresinol possesses antioxidative, a lesishmanicidal activity and cardiovascular disease risk reduction, it has antiamyloidogenic activity via reduction in the amount of α²-secretase, it is a potentially valuable antiamyloidogenic agent for the prevent

Rivastigmine tartrate (SDZ-ENA 713) is a carbamate-derived reversible CHOLINESTERASE INHIBITOR that is selective for the CENTRAL NERVOUS SYSTEM and is used for the treatment of DEMENTIA in ALZHEIMER DISEASE and PARKINSON DISEASE.

Ambrosin is a sesquiterpene lactone and a potent NF-κβ inhibitor. It is currently being studied as a potential lead drug for Alzheimer disease therapeutics.

Isoastilbin is a dihydroflavonol glycoside compound found in Rhizoma Smilacis glabrae and Astragalus membranaceus. Isoastilbin inhibits glucosyltransferase (GTase) with an IC50 value of 54.3 μg mL and possesses anti-acne and tyrosinase inhibition properties. Additionally, isoastilbin demonstrates neuroprotective, antioxidation, antimicrobial, and anti-apoptotic properties, indicating potential for Alzheimer's disease research.

[Arg6]-β-Amyloid (1-42), England mutation, is a biologically active peptide linked to autosomal dominant Alzheimer's Disease in various kindreds. The English (H6R) mutation disrupts H6 interactions due to alterations in the beta-amyloid precursor gene.

Brilaroxazine (RP5063) is a potent multimodal dopamine/5-HT modulator. Brilaroxazine is a partial agonist of dopamine D2, D3, and D4 receptors, 5-HT1A (Ki =1.5 nM) and 5-HT2A (Ki = 2.5 nM), and has antagonist activity 5-HT2B, and 5-HT7 receptors with Kis of 0.19 nM and 2.7 nM, respectively. Brilaroxazine can be used for research about cognitive impairments in neuropsychiatric and neurological diseases.

THK-5117 is an arylquinoline derivative with the potential as a PET probe for tau imaging. THK-5117 shows high binding affinity to tau fibrils with a Ki value of 10.5 nM. THK-5117 also shows high binding affinity to tau protein aggregates and tau-rich Alzheimer disease (AD) brain homogenates [1].

SV5 is a potent anti-Alzheimer agent that significantly protects SHSY-5Y cells from Aβ1-42-induced death. It is highly stable, has optimal pharmacological properties in human plasma, and demonstrates appropriate antioxidant and good neuroprotective activity.

Rasagiline-13C3is intended for use as an internal standard for the quantification of rasagiline by GC- or LC-MS. Rasagiline is an inhibitor of monoamine oxidase B (MAO-B; IC50= 4.43 nM for the rat brain enzyme).1It is selective for MAO-B over MAO-A (IC50= 412 nM for the rat brain enzyme). It inhibits serum and NGF withdrawal-induced apoptosis of PC12 cells when used at concentrations ranging from 0.01 to 100 μM.2Rasagiline inhibits rat brain MAO-Bin vivo(ED50= 0.1 mg/kg).1It reduces cerebral edema in a mouse model of traumatic brain injury.2Rasagiline (0.1 mg/kg) reduces cortical and hippocampal levels of full-length and soluble amyloid precursor protein (APP) in rats and mice. It also reduces α-synuclein-induced substantia nigral neuron loss and improves motor dysfunction in a mouse model of Parkinson's disease.3Formulations containing rasagiline have been used in the treatment of Parkinson's disease. 1.Youdim, M.B.H., Gross, A., and Finberg, J.P.Rasagiline [N-propargyl-1R(+)-aminoindan], a selective and potent inhibitor of mitochondrial monoamine oxidase BBrit. J. Pharmacol.132(2)500-506(2001) 2.Youdim, M.B.H., and Weinstock, M.Molecular basis of neuroprotective activities of rasagiline and the anti-Alzheimer drug TV3326 [(N-propargyl-(3R) aminoindan-5-YL)-ethyl methyl carbamate]Cell. Mol. Neurobiol.21(6)555-573(2001) 3.Kang, S.S., Ahn, E.H., Zhang, Z., et al.α-Synuclein stimulation of monoamine oxidase-B and legumain protease mediates the pathology of Parkinson's diseaseEMBO J.37(12)e98878(2018)

Lazabemide (Ro 19-6327) is a selective and reversible monoamine oxidase B (MAO-B) inhibitor with IC50 values of 0.03 μM for MAO-B and >100 μM for MAO-A.

β-Amyloid (42-1), human, is the inactive form of Amyloid β Peptide (1-42), which plays a pivotal role in the pathogenesis of Alzheimer's disease.

Myrtenal is a natural monoterpene. It is found to attenuate diethylnitrosamine-induced hepatocellular carcinoma in rats by stabilizing intrinsic antioxidants and modulating apoptotic and anti-apoptotic cascades. Myrtenal also inhibits acetylcholinesterase

IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO) with potential for Alzheimer Disease research [1]. (MCE IONIS-MAPTRx for murine use [3]: Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′)

Iclepertin (BI-425809) is an orally active and selective inhibitor of glycine transporter protein 1 (GlyT1).Iclepertin is used for the treatment of central nervous system disorders such as Alzheimer;s disease. Iclepertin is used for central nervous system disorders such as Alzheimer;s disease, schizophrenia and cognitive disorders.

(S)-Rasagiline mesylate is rasagiline S-isomer, and is an agent of anti-Parkinson.

Rasagiline (AGN1135) is an inhibitor of monamine oxidase used as adjunctive therapy in combination with levodopa and carbidopa in the management of Parkinsons disease.

Rasagiline 13C3 mesylate racemic is the deuterium labeled Rasagiline, which is an irreversible monoamine oxidase inhibitor.

Racemic rasagiline, also known as AGN-1135, is a Monoamine Oxidase type-B inhibitor (MAOI). However, application of this drug can lead to fatal hypertensive crisis in patients who consume tyramine-rich foods. TVP-1022 is the (S)-isomer os Rasagiline and acts as a cardioprotective agent.

(S)-Rasagiline is rasagiline S-isomer, and is an agent of anti-Parkinson.

Rasagiline Mesylate (AGN1135) is a novel MAO-B inhibitor, which can treat idiopathic Parkinson's disease.